You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
spoIIIE [2018-02-16 08:55:28]
ATP-dependent dsDNA translocase, resolution of chromosomal dimers after
DNA replication, transports the forespore chromosome across the
sporulation septum
Molecular weight
86.96 kDa
Product
ATP-dependent dsDNA translocase required for chromosome partition
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,752,272 → 1,754,641
The protein
Catalyzed reaction/ biological activity
transports the forespore chromosome across the sporulation septum PubMedtranslocates septum-entrapped DNA only when septum closure precedes complete segregation of chromosomes PubMedthe two DNA translocases SftA and SpoIIIE synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively PubMedbinds DNA sequences named SRS for SpoIIIE recognition sequence, GAGAAGGG PubMed Paralogous protein(s)
Domains
N-terminal transmembrane domain (4 helices) PubMed134 aa linker PubMed512 aa motor domain at the C-terminus PubMed Structure
2IUT (FtsK from Pseudomonas aeruginosa, partial, 48% identity, complex with SftA) PubMed Localization
transmembrane domain mediates dynamic localization to active division sites PubMedcomplexes are recruited to nascent sites of septation, and are subsequently escorted by the constriction machinery to the center of sporulation and division septa PubMed Expression and Regulation
Biological materials
Mutant
BKE16800 (ΔspoIIIE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTTBKK16800 (ΔspoIIIE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACACTCATCACCTTACTGC, downstream forward: _UP4_TAATGAAGGGAGTTCCGCTT References
Reviews
Loading
Original publications
Loading